Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11718F10
Clone ID IST11718F10
Vector VICTR76
Project tigm

Sequence tag IST11718F10HMF1
Sequence
NAACCTACTATACTGCCTGCCATATTTGAGATATTTAAGAAATGTACATCTACTGCCGAAATGCATGCATTTAGATTCTG
CTGAGATGTAAGAAGCAGCTAAGAAACGCAACTGCTAGAGAATCTACTTCACCTCTCCCCCTGCCATTCCTAACTTCTGT
CCCTTCANCATGACCAACANCATCTCNNATGTTTCTTTNNNNCTANCTGTCNGTGGAAGATGTATGGTANACTGAATTTC
CAAAGAGGATTGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11718F10BBF1
Sequence
GAACCTACTATACTGCCTGCCATATTTGAGATATTTAAGAAATGTACATCTACTGCCGAAATGCATGCATTTAGATTCTG
CTGAGATGTAAGAAGCAGCTAAGAAACGCAACTGCTAGAGAATCTACTTCACCTCTCCCCCTGCCATTCCTAACTTCTGT
CCCTTCANCATGACCAACANCATCTCNNATGTTTCTN
Sequence Type genomic DNA
Unitrap ID UNI25563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 42322223..42322418 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047261 (Gap43) NM_008083 growth associated protein 43 Gene [Source:MGI (curated);Acc:Gap43-001]

 
Come back to gene ENSMUSG00000047261


For any suggestions or comments, please send an email to unitrap@crg.es