Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14689B6
Clone ID IST14689B6
Vector VICTR76
Project tigm

Sequence tag IST14689B6HMR1
Sequence
GGANCTCTTGTTTGTGCTTACACAATAAGCACCTCATTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37108722..37108766 43
NO GENE  


Sequence tag IST14689B6HMF1
Sequence
ATCCTGAATTCTAACACTGAGAATCTCATAGGACAAAGGTCCTTAACAGGACTCAGAGAGAGCAGATGTGTCAAAGAGCA
CCAAGTACAGGAGGAAGTGGGCTTTCCTAAGTCCCCAGTGTGAGGTTTTTGTCTTCAAGGTGTCTGTGGTGGGGAANCCN
TGGGTTGGGAAGTCCCTTGTCCCTTCTGAATTCTCTCTGGGTAGCTTACAAACTGTGTCANTTGCNCTGTTCTTCCATCT
GGACCCATGTTCTCACTCCCANTGCANGTNNNAATTTTANANAACTATTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37108436..37108725 268
NO GENE  


Sequence tag IST14689B6BBF1
Sequence
ATCCTGAATTCTAACACTGAGAATCTCATAGGACAAAGGTCCTTAACAGGACTCAGAGAGAGCAGATGTGTCAAAGAGCA
CCAAGTACAGGAGGAAGTGGGCTTTCCTAAGTCCCCAGTGTGAGGTTTTTGTCTTCAAGGTGTCTGTGGTGGGGAAGCCA
TGGGTTGGGAAGTCCCTTGTCCCTTCTGAATTCTCTCTGGGTAGCTTACAAACTGTGTCAGTTGCGCTGTTCTTCCATCT
GGACCCATGTTCTCACTCCCAGTGCATGTAGGAATTTTAGAGAACTATTCACAGTCACTGTGGTTCTTCCCACAACCCAC
AGTGCTAGAAACTCCACAGANAGGAACAAAGTCTCAGTCCCTCCAGACTTTCCACACATCAAGGATGGGGCCTACAGCAC
CCTGTGCCACCCTCCTGCTGCTCTCAGCATTCCTGGCTCTGATCCAGACNAAGAACCNGNNCTTTGCTGGTTATGGTTAG
TGTGNGTCTGGANGNGAAACANCTCCN
Sequence Type genomic DNA
Unitrap ID UNI14476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37108221..37108725 486
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es