Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13695G5
Clone ID IST13695G5
Vector VICTR74
Project tigm

Sequence tag IST13695G5BBF1
Sequence
AAGTAGGTATGCTGTTCTGGAAACAGACATGGGAAAAAGCCTTGCGCTACAGGCATGGGATGCGCCCTAANAATTGGCCT
GAGTTTAAACTGTAGAGTTTTTATTTCGTTTTTGATTTGTTTTAGTGTCAGCTTTTGTGTGTATTGAACACACATACCAC
TGAGCTCCGGGCAGTGGGTGTTTACTTTATTCACCTGTTTGTTGCATTGTTATGAGTGGGTGTGTGGAGGTCAAAGGGAT
GACTCTCANCANGTGGTTCTCTCCCTCTGTGTGGGTCCTGGGGATCTCACTGGCCCNTTTGTNNNGGCTTTNGGTTANTG
TTTTTGGGGGTTTNNGNGN
Sequence Type genomic DNA
Unitrap ID UNI21103

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121990162..121990494 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029454 (Mapkapk5) NM_010765 MAP kinase-activated protein kinase 5 Gene [Source:MGI (curated);Acc:Mapkapk5-005]

 
Come back to gene ENSMUSG00000029454


For any suggestions or comments, please send an email to unitrap@crg.es