Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14134D6
Clone ID IST14134D6
Vector VICTR74
Project tigm

Sequence tag IST14134D6HMF1
Sequence
GTTGTGACAAAAAATANTAATGGTGAATTGGTGCTTTTGTTTTTGCTAANCTCTCANATTACTTAATTTTCTTCCAAAAA
GTAATGACTTGGGATTTGTGGCTATACGTGACACACATATATAACCATAATGGGATTGTTTAAAGAATTTGACCATTCNA
CCCGGTAAGCATAAGGGANCGCTCAGCAGGGCCTTGGGTTGGATACCTGGGCCTGCANCTTGCCTGGCTGCCTAATGGCA
GCCCTGANAANCCTAACCTGCGGGGCACCCTAAGTCTCACTGTCTGTTTTCACNTTCCCTATCCTGGAAACGTGTGCGTG
GGGTTTCTTTGTTTTCCTANCGCANTGTGTCCCACAGCTCGCGGGN
Sequence Type genomic DNA
Unitrap ID UNI2821

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5189398..5189762 341
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069729 (Arid1b) AT rich interactive domain 1B (SWI-like) Gene [Source:MGI (curated);Acc:Arid1b-001]


Sequence tag IST14134D6HMR1
Sequence
CNCAACCNAGTGCTATATATGAAACTTTTGGATAATGTTACAGATATTTAAAGAAATGAACACATGATTTTAAATGCTGT
TACTGTTGTCATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5189309..5189401 91
NO GENE  

 
Come back to gene ENSMUSG00000069729


For any suggestions or comments, please send an email to unitrap@crg.es