Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13940F7
Clone ID IST13940F7
Vector VICTR74
Project tigm

Sequence tag IST13940F7BBF1
Sequence
CGTGGAGGAAGGAGGCCCAGCCCAAGAGGCAGGGCTCTGTGCTGGGGACCTCATCACTCACGTGAATGGTGAGCCCGTGC
ATGGTATGGTGCATCCTGAGGTGGTAGAGCTGATCCTGAAGGTGAATGTAGGGATGGGCTTCGATGGGTGGGGGGTGTN
Sequence Type genomic DNA
Unitrap ID UNI36525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87439542..87439699 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]

 
Come back to gene ENSMUSG00000053693


For any suggestions or comments, please send an email to unitrap@crg.es