Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14786B8
Clone ID IST14786B8
Vector VICTR76
Project tigm

Sequence tag IST14786B8HMR1
Sequence
TGTNGANTGNNCNCTAATGANTAGGTGGCCTGAANTCATCTCTANTCTGGCCTTGAATCCCGTCCTGGGTAAGGAGTCAT
TCTTTTCCTAATTGCACTAGGGAGTCACTGAATGGGTTTAAGCTGGAATGCTTTGAGGTCTATTTACATTTTAATGTTAT
CGTTCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14786B8HMF3
Sequence
AAAGGACGTTANGCNGANANTCNANATGCAGCCCCNGANNCTCANGTTCNCTGCCTCTGTANTNACTCCCCATGCCNNAN
AAANCGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14786B8BBF2
Sequence
CAGTTGCCTCTAGAAACATTATCCTGGCCAGGAGACCCCGTCGGCCACGCTCGGATCTTCCTTTCCGATCCGCCATCGTG
GGTGGAGCCGCCGCCACGATGCAGATC
Sequence Type genomic DNA
Unitrap ID UNI14827

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 29447720..29447896 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020460 (Rps27a) NM_001033865 ribosomal protein S27a Gene [Source:MGI (curated);Acc:Rps27a-003]

 
Come back to gene ENSMUSG00000020460


For any suggestions or comments, please send an email to unitrap@crg.es