Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11467C4
Clone ID IST11467C4
Vector VICTR76
Project tigm

Sequence tag IST11467C4HMR1
Sequence
TAGATCCCTTTAAGATACTATAAAGCATTTATTAAACTCTTTGACATTAAAATATTAGATTTTGAAAATAAAGGTAAGAC
TTAAATAGTGTGCATGGGAATGCACTAAATAGTATGCACGGAGATACAATTTCTCTCTTTTTTGTCTTTTAAGAAGTTAA
AGTTTTAAAATTTTACAATACCTAAACCTTTGAATTAATAACTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469503..7469709 207
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52079197..52079403 207
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 87789267..87789473 207
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919786..52919992 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940229..136940435 207
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 91356423..91356629 207
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124749517..124749723 207
NO GENE  

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es