Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10031E4
Clone ID IST10031E4
Vector VICTR75
Project tigm

Sequence tag IST10031E4HMR1
Sequence
GGAGCATTTCAGGAAAAAAGACAATGAGCTTTGCGACAACCTAGACACCACATATCTGGAGTGAACAGATTACANGNNAN
NANACNTNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104149049..104149122 74
NO GENE  


Sequence tag IST10031E4BBF1
Sequence
TTCCCTGGTCGGCTGTCTTGCTTCCCAAGTGGGTTAGTTATAGTGCCACTGTTGGCTGCTGGAACCCAAAAGCTCTACCA
ACTGAAGAGGCTTTTTGCCTTGCAATCATAAGATACCCGGACATGGGCATAGCTCCCTAACGCCATGTATGCGCTTCTGT
CTTTGTCTTCTGCCATCCTACGTGGTTGGACTGTTGCTTCATTGTTGAAGAATAGCTGCTGCGCTCCCAAACACTGTCAT
CTGCCTTGGAACAAGAACCATGGCTGGTGAGACAGCTCAGAGGATGAAGGCGTTTACCATGCAAGCCTGGGGACCCGAGT
TCAATTCCCCAGAACCTTTGTAAAGGAGGAAGGACAGAACCGACTCTACAAAGTTGTCCTTTAAGTTCCCACACACTGTG
ATGGCATGTGCCCACAGAGATGTATTACACACGTGTTCCATAATAATGAATGAAAGACAGGCACAGGTGGTGCACGCCTT
TAATCCCAGCACTTGGAGGCAGAGGCAGGCAGATTTCTGAGTTTGAGGCCAGCCTGGTCCACAGAGAGGGCTTCCAGG
Sequence Type genomic DNA
Unitrap ID UNI30826

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104149120..104149676 548
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es