Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10719F2
Clone ID IST10719F2
Vector VICTR76
Project tigm

Sequence tag IST10719F2HMF2
Sequence
CATACTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCTACGCACCAAATGCCAGGGCAGCCACAT
TCATTANAGACACTTTAGTAAAGCTCAAAGCATACATTGCACCTCGCACAATAATAGTGGGAGACTTCAACACACCACTT
TCTTCAAAGGACAGATCGTGGAAACAGAAACTAAACAGGGACACAGTGAAACTAACAGAAGTTATGAAACAAATGGACCT
GACAGATATCTACAGAACATTTTATCCTAAAACAAAAGGATATACCTTCTTCTCAGCACCTCACGGGACCTTCTCCAAAA
TTGACCATATAATTGGTCNCAAAACAGGCCTCAATAGATACNAAANTATTGAAATTGTCCCATGTATCCTATCAGANNNC
CATGGCCTAAGACTGATCTTCAATAACG

Sequence Type genomic DNA
Unitrap ID UNI33841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 145530616..145531042 413
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028194 (Ddah) NM_026993 dimethylarginine dimethylaminohydrolase 2 Gene [Source:MGI (curated);Acc:Ddah-001]


Sequence tag IST10719F2BBF1
Sequence
GTTGTATTGAAATATGTAATTGTGTTAAATCTTTNCTCTGANTGTCCCCTCCCCTGCCCCACACCATCCCTGAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI33565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109573094..109573171 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031916 (Cog8) NM_139229 component of oligomeric golgi complex 8 Gene [Source:MGI (curated);Acc:Cog8-001]

 
Come back to gene ENSMUSG00000031916


For any suggestions or comments, please send an email to unitrap@crg.es