Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12514G2
Clone ID IST12514G2
Vector VICTR76
Project tigm

Sequence tag IST12514G2HMF1
Sequence
CTCACTCGCCTCGCTCGCTCACTTTGCTGCCTCTGATCATCCTTCCAGTGTGCTGTGAGCACTCCTCTCCTCTTGTTTAC
TAGTTAGAAAGTCATGCTTTCAATTGTCCATAAAGCAGTCACAATTTGAACTCTGCCAGAAGTAGGTAGTTATTCTGGTC
CATGTAATAGCATTAAGATGTTCACTTTATGTTCACAGAATATTTTACTTAACAGTAAAGAGAATAAAATTAAAAGTATT
CTAAAAACACAAAGTTTGCAATCAGAGCCAATTCTGTCTCTTTGCAGAAGTGTTTTAACTTTGGTGCCTGCCTGTGTTTT
TCANAANGGCGCTCTAATGGAACAGATAGCACACCAAGCTGTGGTAATGCAGTTTATTATGGAAATGGA
Sequence Type genomic DNA
Unitrap ID UNI13407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 29081739..29082126 384
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024780 (Cdc37l1) NM_025950 cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene [Source:MGI Symbol;Acc:MGI:1914322]


Sequence tag IST12514G2BBF1
Sequence
CTCACTCGCCTCGCTCGCTCACTTTGCTGCCTCTGATCATCCTTCCAGTGTGCTGTGAGCACTCCTCTCCTCTTGTTTAC
TAGTTAGAAAGTCATGCTTTCAATTGTCCATAAAGCAGTCACAATTTGAACTCTGCCAGAAGTAGGTAGTTATTCTGGTC
CATGTAATAGCATTAAGATGTTCACTTTATGTTCACAGAATATTTTACTTAACAGTAAAGAGAATAAAATTAAAAGTATT
CTAAAAACACAAAGTTTGCAATCAGAGCCAATTCTGTCTCTTTGCAGAAGTGTTTTAACTTTGGTGCCTGCCTGTGTTTT
TCAGAAAGGCGCTCTAATGGAACAGATAGCACACCAAGCTGTGGTAATGCAGTTTATTATGGAAATGGCCNAAAACTGCA
ATGTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI13407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 29081739..29082147 407
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024780 (Cdc37l1) NM_025950 cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene [Source:MGI Symbol;Acc:MGI:1914322]

 
Come back to gene ENSMUSG00000024780


For any suggestions or comments, please send an email to unitrap@crg.es