Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0302
Clone ID GC0302
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0302
Sequence
CTTTCTCCTTGGACTTTCTATCTTGTTCTCTGTCCCGACTTTTGCTCCTGTGCTTATATGACTTTCGATCTCGGCTTTTT
GACCGTCTTCGATCCCGACTGCGAGATCTATGTTTTCTTTCTGATCTGTCATGGCTTCTGCTTCTTCGTCGATCTCTACT
TCTGCTTCGCCTTCTGTCTCTACTCCGTGATCTTTTGTGGTCCCGAGACCTGCTGC
Sequence Type mRNA
Unitrap ID UNI49

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 94157234..94158252 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020863 (3300001P08Rik) NM_026313 RIKEN cDNA 3300001P08 gene Gene [Source:MGI Symbol;Acc:MGI:1914934]

 
Come back to gene ENSMUSG00000020863


For any suggestions or comments, please send an email to unitrap@crg.es