Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14941A8
Clone ID IST14941A8
Vector VICTR76
Project tigm

Sequence tag IST14941A8BBF1
Sequence
CTNCAAGGNNNNANNNNNNNTAANNNNNNNNNNNNNNNNNNNNCNNNCNNANNNNNNNNNNACAACATCCCCTGNNNNCA
AGAACATCCATCCTGTTCTTATTCCCGCCATTTTGACCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14941A8HMR1
Sequence
GAAAGTCATATTCACAATTAAAAACTAGGAATTAGCAGTGAAAAATTATTGTTCTTGAACATTTTTTTCTACAATCTTGA
NNGNATTTTCAGATGTTTTTCTGTACGTGCATACATTAATATATGTACATTAATATTATAGTCATGANTATATAATACAT
TCTATAGTAATATATCATCNNNNNNNATTATCATTAATTATTAATTATATTCTTAACAAGCACATATAATATTACATTAT
TACATATTATTGTATATGCATATACACATTGATTTTGTACAAGTATTACATATAATAAAATATATGTGCATTAATGTTAT
GTATACATACGTGTCATAGTCNGGGTTTCTATTCCTGCACAANCATCCNGACN
Sequence Type genomic DNA
Unitrap ID UNI10430

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126140252..126140623 344
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]


Sequence tag IST14941A8HMF1
Sequence
TTTCAAGTAATAATAAACCAATTTAATCTGCTTCTTATTCGACTAACCCCTCCAACTACACATTCCACAACATCCCCTGC
AAGCAAGAACATCCATCCTGTTCTTATTCCCGCCATTTTGACCTTGCCTTTTAACTTCTTTCTCTACCAGCTCCTTTAGT
AAGTCTCTAGTCTCTGTGCTCATGCACATCAGCAAATATTAGACTATGCTCCGTGCTACACTCCGTCTAGCCGGCATGCT
TCCTCTTTTCCCTGTTTAATAAATTGGACTTGGTGCCACCTGCGGGCATCGCTTACCGGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126140620..126140920 301
 
EST/CDNA Est Name
  NM_153403.1 - BC129915.1 - BC129914.1 - AB081471.1

 
Come back to gene NM_153403.1 - BC129915.1 - BC129914.1 - AB081471.1


For any suggestions or comments, please send an email to unitrap@crg.es