Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14447E4
Clone ID IST14447E4
Vector VICTR74
Project tigm

Sequence tag IST14447E4HMF1
Sequence
TCTCATGCAGGTTCTTGAAAGGAAGGAGGGAAGGAAAGAGAAGGGAGGAAAGAGAAGGAAGGAAGGGGAAGGAAATANAA
GGGAGGGGAGGGGAANAAAGGGGAGGAGAGCGGAGCGGANAGGAAAACTCTTGCNTCTGGCTTNNNTGGANANGCNTANT
NNCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14447E4HMR1
Sequence
NAGTGCACGAGCCAGCCTTGGGAAAACCCTAGCATGANTCATTGTTTGGAACCACAGTCTGCCTTCCTCTGGATCACCTT
CCTGGTTGAGGTCATAAGACTAAAATAAGCTGCAGCCCCTCCTTCACGGGCACAGGACACCAGTGAGGAAGGCGGCTTCA
GGCCAAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI14507

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135185019..135185187 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es