Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12032E4
Clone ID IST12032E4
Vector VICTR76
Project tigm

Sequence tag IST12032E4HMF1
Sequence
TGGGTACCAGACAGGCAAGGCAAATGGTGCAGAGCTGTATGTGTGAGCAAAACACCTATACACATAAAATATGTTTTTCA
AAACAATCTCTTAATAGGTAAAGTACCATTTTATTTACACATCAAATTAATAGATATCCTAAATGTGAATAACATTCAGT
GCATAGAACGGTAAAATCTTTACCTTTGAGGCCAAGACCCAGTAGAAAGCTGTTGATTCTAACTTTACTTTGGAGGTGCA
AGCCTCCCCCTGACACAAGTGGTGGAGGTCTTCCTTTATCANCATTATCTAACTANTTTTGAGAAGAGATGTTTTCATGT
GTGTTAGTAACTAGAAGTCATCTTTGTGGTAACTATGCATTTTGTCTTANTCNATGCATGTTGATGTCTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI30975

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 109985758..109986156 391
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028546 (Elavl4) NM_010488 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene [Source:MGI (curated);Acc:Elavl4-001]

 
Come back to gene ENSMUSG00000028546


For any suggestions or comments, please send an email to unitrap@crg.es