Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14778C2
Clone ID IST14778C2
Vector VICTR76
Project tigm

Sequence tag IST14778C2HMR1
Sequence
CTACCACTGAAGAACTCATAGCCNTCTTCTGCGATTTGCTAGGAAATCTGATTTNNACAATCCGTGCATCATTTCTGCCA
GAATAGGGCTGAGTCCAACCTGTTGCTTCATTTTCCTTCCTCATCAATTGATTTATTTATTCTTTTAAAATCTTCATAAA
TGTAGATAATGTGTCTCGATCACCATCACTTTCACTCCCATTCCCGCTCCCTCTGGGACCACTGTCCTCCCACTGGCCCT
CATGCCCGCCATATGTATACATGTATGTATGCGCGTATTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72718605..72718887 273
NO GENE  


Sequence tag IST14778C2HMF1
Sequence
TTAGAAAGCATTCTTGAGCCCAGAATCAAACAGGCTCCTGGCTGCTCTCCCTTTACTCTTGGGGGACTGCGGAGGTGAGA
CTACAACAGCACCCCAGAAGGATCACGTTTCTGCTGTGCCTTGTAGGATATAAGACTGAGCTCATGGTAGTGAGGTAGTG
TGCATGTCTTTATTTCATGCTAAAACAAACAAACAAATAAACAAAAAACGTATTTTGGAGAGAAAGAAATAGTATGCTCC
CCTATTTCATGAAGTTGTTGGATTTATCTTTTAAAAATAGTTCACTTTTCCAAAAAATGTCNAACCCAGTGAGACCTTTG
TGGATANAACTTTCNGGGTTNNACCGCTGAATTTTGAANTCCTGTCTTGAANAACCTCN
Sequence Type genomic DNA
Unitrap ID UNI13027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72718885..72719261 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es