Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13235H7
Clone ID IST13235H7
Vector VICTR74
Project tigm

Sequence tag IST13235H7BBF1
Sequence
GTTCGAGGCCAGCCTCATCTGCACATTGAGTTCCAGAATAGCCAGCCAGAGCAAAATAGTGGGATCTGTCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16869995..16870065 67
NO GENE  


Sequence tag IST13235H7HMR1
Sequence
GCCGCCAGGGGGCGCGGCACCCTCCCGGGCCGTTCCACGGCGCTCCGTGGTTCCCGCTGCCCGGCTGGAGGCC
Sequence Type genomic DNA
Unitrap ID UNI29669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 43199673..43199744 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038214 (AK122525) NM_199028 BEN domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2677212]

 
Come back to gene ENSMUSG00000038214


For any suggestions or comments, please send an email to unitrap@crg.es