Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST434755
Clone ID OST434755
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST434755
Sequence
TGAGGACTTGGTGACCTTTGAGGATGTGGCTGTGAACTTCACCCAGGAAGAGTGGACTTTGCTGGATCCTTCTCAGAAGA
ACCTATACATTAATGTGATGCTGGAGACCTGCAGTAACCTTGCTTCTGTGGGAATCAAATCAGAATACCAGACCATTGAA
GACCAGTATAAACAGCCTGGGAAAAATATAAGGAACATCATAACCCGCTCCGGATACACTCCATACGCACTTGAGGACTG
TGGGGAGAAGCCATATCACTCCAGTTCTCTCACAACAATTCACATATACGTGGGAATCCACACCTGTGAGCGGAGCGTTA
TTGGGGG
Sequence Type mRNA
Unitrap ID UNI8660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 46789161..46790233 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068959 (Zfp619) NM_001004139 zinc finger protein 619 Gene [Source:MGI (curated);Acc:Zfp619-001]

 
Come back to gene ENSMUSG00000068959


For any suggestions or comments, please send an email to unitrap@crg.es