Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST434699
Clone ID OST434699
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST434699
Sequence
TGAGTATCCCGGCTGCACTGTGTAGTAGTGAATCTTTCAAGCATGGACCTCATCTTAGATGTAAACATTCAGATTTACCC
TGTGGACTTAGGTGACAAGTTCCGGTTGGTTATAGCTAGTACTTTGTATGAAGATGGTACCTTGGATGATGGTGAATACA
ACCCCACAGATGACAGGCCTTCCAGGGCTGACCAGTTTGAGTATGTCATGTATGGGAAAGTGTACAGGATCGAAGGGGAT
GAGACCTCCACTGAAGCAGCCACACGCCTCTCTGCGTACGTGTCCTATGGGGGCCTGCTCATGAGGCTTCAGGGTGATGC
CAACAACCTGCATGGATTTGAGGTGGACTCCAGAGTTTATCTGCTGATGAAGAAGCTGGCCTTCTGAACTTCGTGGGAAA
CCAGACTTGCTGCTTAGTCACTCATGTCATGGACACTGTTCAAGGCTGTGTAGAAGCTGTCGGTGTTAGCCTGTAAAAGG
GGCGGAACTCTGTCCACTGTGGGGTCTAGTCTCTCTC
Sequence Type mRNA
Unitrap ID UNI13229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20718895..20722217 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021018 (Polr2h) NM_145632 polymerase (RNA) II (DNA directed) polypeptide H Gene [Source:MGI Symbol;Acc:MGI:2384309]

 
Come back to gene ENSMUSG00000021018


For any suggestions or comments, please send an email to unitrap@crg.es