Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10545H10
Clone ID IST10545H10
Vector VICTR76
Project tigm

Sequence tag IST10545H10BBF1
Sequence
CCATGTGGTTGCTGGGATTTGAACTTCCGACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGC
CCGGCTCTCATCTTTCATTGTGTTGTATTTAGCGTGCCTTANNTTAATTTCTCTAGCTGTCTTATTTTTGCAAACAGAAN
GACACNAATCAGCTATTGGAAAGAAGTGAATGTTCGCTATTGAATAGTTACTGTGGGTACTTCTTCCCGGATGTGTTTCT
GTCAAAAGATAANACACTGTCTGGATTGTGTTTTTCTTTGGTCTAGCCATGGAATGACTTTATTTCCNATCGGGTANCAA
AGGAAGTGAGANGCTGACTTTGAACANAGACTTGCAGGCGGTGGGGGCCTTGGCTGCTCANNAGCTCCACTTANCCTGAA
GANAGTCCCANTNAAGCTGCCTACCNAGGGCAAGCCCCAANGCTTCCTGGGACAGCTGTGGGGTTGCANGTGGCTTTAAC
AGANCNATGGTGTCACACTGANCN
Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66541939..66542439 461
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST10545H10HMF1
Sequence
ACTATCACGTTACGAAATTTGGCTGTCAGTTTATACCTATGAATGTATGACAGTGCAAATTTTAATGCTTTATTAAAGAG
ACATTGTTTTAAATCTTATCTTTAATTCTACCTTCTAGGATAAGAATCACTTTAAATATTATCTCAACTAGAAGCATCCC
TAAGAGGCCTAGTTTTTTGGCTTGCATTACACCACATGTTTGAAAGACTCGAAACCTGAGCTACCAATTTAACGCTAACT
TTCTAGTAACCAGTGTTACACCTTTTTGATCATACCCAATAACTTATAAGCTAATACTCTATGATGAAGACNCGCAGAGC
ATATTATACCTCCTCTAAGACCAGTAAAAAACCAAATAAAGCAGCTACACAAGTCTTATAAATTTAGACCAATCAAAGAA
TTTTACCTTTTATAGCTATAATTATAAGATAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5598441..5598877 435
 
EST/CDNA Est Name
  BB565641.1


Sequence tag IST10545H10HMR1
Sequence
TGGTGGCTCACANCCTCCGTGACGAGATCTGACGCCCTCTTCTGGAGTGTCTGAAGACAGCTACNGTGTACTTACATATA
ATAAATAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66542437..66542527 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45941175..45941265 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 21049557..21049647 83
NO GENE  

 
Come back to gene BB565641.1


For any suggestions or comments, please send an email to unitrap@crg.es