Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10469E11
Clone ID IST10469E11
Vector VICTR76
Project tigm

Sequence tag IST10469E11HMF1
Sequence
CTCCTACNAGTTGGCCTTTAATCAACACACACNCNCNCACACACACACACACACACACACACNNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10469E11HMR1
Sequence
NNTGTGGATCTTGGGGACCCAACTCAGATTGAAAGCCTTGATGAGAGGCACCATTAGCTACTGACCNCCTCACCTGGTTT
GTTTTGTTTTGTTTTCCAGACAGAGTTTCTCTGTGTAGCCCTGGCTGTCTTGGAACTCACTCTTAGACCAGGCTGGCCTC
NAACTCANAAATCTGCCTGCCTCTGCCCCCCAAGTGCTGGGATTAAAGGCGTGAGCCACCNCGCTTGGCTTGAGTTAAAT
AATTGTTTACAGTCTACTNNATNTTN
Sequence Type genomic DNA
Unitrap ID UNI16525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66201815..66202077 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]

 
Come back to gene ENSMUSG00000038664


For any suggestions or comments, please send an email to unitrap@crg.es