Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10601A8
Clone ID IST10601A8
Vector VICTR76
Project tigm

Sequence tag IST10601A8HMF1
Sequence
GTATCTTCCATGTTTATGCAGCCTTTACCTTAGGCCCCTTCTTCTGTTGAGCANAANTCTGCTTCCTTTTCTTTCTTTTG
TTGTTTGAGTAAGTGTGGTGTGTGCGCGAGTGAGGGTCGTGAGGCTCACTACATGTTTGTGGAGGTCAGAGAGTAAACGG
GTGTTGTTAACGCC
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57293056..57293228 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]


Sequence tag IST10601A8BBF1
Sequence
GTATCTTCCATGTTTATGCAGCCTTTACCTTAGGCCCCTTCTTCTGTTGAGCANAAGTCTGCTTCCTTTTCTTTCTTTTG
TTGTTTGAGTAAGTGTGGTGTGTGCGCGAGTGAGGGTCGTGAGGCTCACTACATGTTTGTGGAGGTCAGAGAGTAAACGG
GTGTTGTTGACGCTTGGCATCCTTCCGTGTTGGANATCANGGTCTCTCTTCTGCATTCCACTTCTCTGTACCGTATTCCA
GGTGAACTGGCCCCTGNNCTTCTGGAAATTCTGTCTCTGCCTCACATCTCCCCACAGGAGCTCTGGGAGCCTTCACAGAA
NGTGATTCANACTCCCGGTTGTTACTCTCCAATGGAAAANACTTACCCACTGAGCCNCCTCCCANGCNCTGAACCGGTTC
ATGTCNNCTCTTTAACCATTGAGTTAAAAANAATCAGTCCNGTGGATTGGGCTNANGTGTACATTCTCTGCTAATCTNAN
AACTGGCCTNGNAN

Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57292740..57293228 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]

 
Come back to gene ENSMUSG00000038764


For any suggestions or comments, please send an email to unitrap@crg.es