Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10885F2
Clone ID IST10885F2
Vector VICTR76
Project tigm

Sequence tag IST10885F2HMR1
Sequence
ATTAAAATAATCTATTCNCCTCAGTAAATATAGGCATGTTACCTGTCTTTAATATAGAATGAATATTAAAAACATCATCA
GCAAATTGGGATTTTTATACCCTAAATTTATTTTCTTTCTTGTTTGTTTGTTTGTTTGTTNGTTGTTGNTTTGTNTN
Sequence Type genomic DNA
Unitrap ID UNI32901

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8820121..8820274 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046634 (Pkd1l1) polycystic kidney disease 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2156538]

 
Come back to gene ENSMUSG00000046634


For any suggestions or comments, please send an email to unitrap@crg.es