Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13731D4
Clone ID IST13731D4
Vector VICTR74
Project tigm

Sequence tag IST13731D4BBF1
Sequence
GACAGATGTCCTATGTACTGTGGCCAATCCCCTCANTGTCTCTGCCAGAAGAGACAACTCTTTTCTTGCTTTTCTGATCT
CAGTTCCTCTTTCTGGTGGGACAGACTGTCGAGCTCAGGTAGGCTCANAGCTGCTCTGTCCTGGCTCAGCCCTCCTCTCT
CCACTCCCTCAGTGGTGCTGATCGGCGAGTCAGGCGTGGGCAAGACCAATCTGCTGTCCCGGTTCACCCGCAATGAGTTC
AGCCACGACAGTCGCACCACCATCGGGGTTGAGTTCTCCACCCGCACTGTAATGCTGGGCACCGCTGCTGTCAAGGCACA
NATCTGT
Sequence Type genomic DNA
Unitrap ID UNI12960

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88349025..88349350 320
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008601 (Rab25) NM_016899 roadblock domain containing 3 Gene [Source:MGI (curated);Acc:Rab25-001]

 
Come back to gene ENSMUSG00000008601


For any suggestions or comments, please send an email to unitrap@crg.es