Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10063C6
Clone ID IST10063C6
Vector VICTR75
Project tigm

Sequence tag IST10063C6BBF1
Sequence
CCTTCGGTCAGCCNTTCCTTCTAAAAAGAGGAGTTTTGGTGCGGTAATTGTAAAGGCCGAAGCGAGAGGTTCTTGGGGAT
TAAGTCCTACTCTGGAAGAGACCGTCCCTTTCTCCCCCTGCCGGCTCCTCCTCGGGACACTTAGCTGAGTCTTTCTTTCC
CTCCTTCCCACGCTGAGGTGAGCGGCACGCAAGCAGGGACGCCTGTTTGTCTTCGGCGCGCGGAGCGAACGCAGCGGGTA
GGAGGCCGGGAGGCAGGAGGGGGAGCGGACGGCATTTGTGGGGAGACAAGGAANGCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84836750..84837045 292
 
EST/CDNA Est Name
  BU758261.1


Sequence tag IST10063C6HMR1
Sequence
AAGGGTTTCCCCTTACCTTGTTGGAGCCTCTTCTANCCCATTGAAAGTGTGTGGGGGGGCAGGGGANNCA
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84837042..84837107 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es