Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14360D3
Clone ID IST14360D3
Vector VICTR74
Project tigm

Sequence tag IST14360D3BBF1
Sequence
AGTTTATGCTCTGGCTGAGGACCAAAATCCCATAGCTGTTTATGAAGGACCCTGTGCTAGGTGTGGAAGAACATGTGTGC
AAAGCAATCTTCCCTGGTGCTCAAGGAAGGCTTCTCTGAGAAGGTGACATTTAAGCAGCAATCCCAAAGATAGACAAGAG
ATTGATGAAACAAAGGAAGGAGACATGGAGAGCTCCAGATGTGTGAAAGGCCTCCCCCACCCCCGACCCNCGTGCCCCTC
TTTGANACNNGGTTTCTATGGGTANCCCTGGCCGTCCTGGANCTTANTCTGTANACCANGATGGTCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 144850087..144850394 290
NO GENE  


Sequence tag IST14360D3HMR1
Sequence
CCCNCACCGCCGGTGTCAGGGCTGTCCCGGGAATGTTN
Sequence Type genomic DNA
Unitrap ID UNI26978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97525284..97525320 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038437 (Mllt6) NM_139311 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 Gene [Source:MGI (curated);Acc:Mllt6-001]

 
Come back to gene ENSMUSG00000038437


For any suggestions or comments, please send an email to unitrap@crg.es