Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST434563
Clone ID OST434563
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST434563
Sequence
TGGACCCACCCAAAGAGCCCAGCANAGGAANCCACCCANAGCGGACCCTGTNCAGGCTGGGCTCTCGNGCCTCCACTCTA
CGGAGGACCGACTCCATCTATGAGGCATCCAGTCTCTATGGCATATCANCCATGGACGGAGTCCCCTTTACCCTGCACCC
AAGATTTGAGGGCAAGAGCTGTGGGCCCTTGAACTTGTCTGCTTTTGGGGACCTGACGATCAAATCACTGGCAGACATTG
AGAAGGAGTATAACTATGGCTTCGNGGTGGAGAATACTGCAGCTGCAC
Sequence Type mRNA
Unitrap ID UNI17871

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74069544..74071700 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031813 (1110012M11Rik) NM_028617 family with sequence similarity 125, member A Gene [Source:MGI Symbol;Acc:MGI:1920961]

 
Come back to gene ENSMUSG00000031813


For any suggestions or comments, please send an email to unitrap@crg.es