Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10922E5
Clone ID IST10922E5
Vector VICTR76
Project tigm

Sequence tag IST10922E5HMF1
Sequence
GGGGAGAAAGGAGACCAAGGGCTAGATATACAGACTTCACCTCTGCANACAGTAACTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109972287..109972345 57
NO GENE  


Sequence tag IST10922E5BBF1
Sequence
GGGGAGAAAGGAGACCAAGGGCTAGATATACAGACTTCACCTCTGCAGACAGTAACTGGCCAGTGAAAGGTGGGGAAGAC
ACCAAAACTCCTGTCCTTTTCCAATGTGAGCTGATTCACACAATTTCTAAATAAATAAAATGTTATTTTATCTCTGANCT
TACTGTCCATATAAGGCTTGACAGGCAGCTTTGTTTTAAGTTGTTGTTTTTTTAACCTGTGTGTGTAANCACACGCACTT
ATGTGCATTGGAGGCCAGAAAGGGACGCTGCACTGTCATCCTCTATCACTCTCCTTACTCCCGTGAGGCAAGGTCTCTTC
TTGAAGCTGGGACTCAAGTTTCATTGGCTAAACTGGAANGTAGCAGCTCCCAGTAATGCTCCTGTCTCAGTGCTGTTCCC
ATTGCAAGGGAAGCTATGTGAACTGTAAAACCCTCCTATGTGCACATAAANNAAATGATTGTGATTCANNAACNCNNGCT
GGGGTCCNAGCNTGCNNGGAACAGCAGCTGNTAGCNNNGNGCTGGNNCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109971821..109972345 487
NO GENE  


Sequence tag IST10922E5HMR1
Sequence
NCCTGCCTGTCTCGGACACATAAGCNATTTTTCTGACTTTCTTTTCTTTCTTCTCTTCTCCCTCCTTCCTGTTTACTCTC
CCCTACTCTGTCTTTCAGAGGTACATGTAAACATGTCCTCATTACTAGCTGGAAAGAGTTACTAGTCATCTGTTTCTGAA
TCACAAGTGGAACACACTCTGTGTTCAGGTTTTATAAGCTCCCTTTAGTCTTGCGGTAC
Sequence Type genomic DNA
Unitrap ID UNI11412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109972344..109972561 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es