Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10046E7
Clone ID IST10046E7
Vector VICTR75
Project tigm

Sequence tag IST10046E7HMR1
Sequence
ATAGAAGAGCCNATTCTAATCTCCAGGGGGATGGCAGCTCTTGTCTCCTCAATGGGGTGAAGAGGCCACTCATGCAGAAA
GTCACTGTAACCCTCTGGACTCTCTCACAGAATAGCTTCATGCCTAAGTAACAGGCTAGGGTCAGACCAGGAGCTATGCT
ACCACAGGTCCCCACTACATCACAACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148251711..148251897 185
NO GENE  


Sequence tag IST10046E7BBF1
Sequence
CTATGAGTATCTTCTATGGGCTTTAAAAAAAAATGCCAGAGATGGTGTCTTCCACTCATACAATTTATATACAGTTTTGC
TTAGAATTTTGAAGTGTGCATCATGGCCATTTTCACATGCCTCAATCAGAACACACACACACACACACACACACACACAC
ACACACACACACACACGCGCGCGCGCGCGCACACACACACACACAG
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148251894..148252098 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es