Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14591G11
Clone ID IST14591G11
Vector VICTR74
Project tigm

Sequence tag IST14591G11BBF2
Sequence
TTATTATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAAAGGGCGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI11071 UNI15524 UNI35641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53494808..53494867 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98938193..98938252 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16305816..16305875 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022792 (Yars2) NM_198246 tyrosyl-tRNA synthetase 2 (mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:1917370]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48074303..48074362 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 146675207..146675266 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078498 (OTTMUSG00000010670) predicted gene, OTTMUSG00000010670 Gene [Source:MGI Symbol;Acc:MGI:3651985]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110646312..110646371 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029502 (Golga3) NM_008146 golgi autoantigen, golgin subfamily a, 3 Gene [Source:MGI (curated);Acc:Golga3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108168126..108168185 60
NO GENE  

 
Come back to gene ENSMUSG00000029502


For any suggestions or comments, please send an email to unitrap@crg.es