Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15105C6
Clone ID IST15105C6
Vector VICTR80
Project tigm

Sequence tag IST15105C6BBF2
Sequence
AACAGATCCTTCTAAATCAATGTAATAATTCACGTGACAGTGATAGCTGCCATTCACACACCTACTCTCCAGTCAGGGTG
TTTGGGAGTGTGCTCAGAGCACTGGGTCCGTCATTGTTCCGTCTGCAGCAGTGAGGCCCAGAAAGTAAGGCAAAGTGCTC
CAGACCTTGCCACTGTGGTGCCAGGCTCCAAAGTCAGATGTTGTATAGGGCTACACCTGTAGGACATAGGCCTTGATCAT
AGGTCACATCACCCTATGATCATCAGTTTGGGGTTTCTGGGCCTGTAAATATTCCCCCACTGAAGCCCCATTTCATTTTT
CTGTTGTCTTATCATTGCCCTCTCCCCTTTTATCCNGACCTGGACAATACCTGTTTTAACTCAATGAACTACTCACCCTT
CAAGGCCTAANTCACTTGTACCAGCTCTGCTACATAAAGCTGTCCAAGCNAGCTCTCTTCATTCTGTCTCCACTGTTCNG
ANCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58303076..58303559 474
NO GENE  


Sequence tag IST15105C6HMF1
Sequence
AACAGATCCTTCTAAATCAATGTAATAATTCACGTGACAGTGATAGCTGCCATTCACACACCTACTCTCCAGTCAGGGTG
TTTGGGAGTGTGCTCAGAGCACTGGGTCCGTCATTGTTCCGTCTGCAGCAGTGAGGCCCAGAAAGTAAGGCAAAGTGCTC
CAGACCTTGCCACTGTGGTGCCAGGCTCCAAAGTCAGATGTTGTATAGGGCTACACCTGTAGGACATAGGCCTTGATCAT
AGGTCACATCACCCTATGATCATCAGTTTGGGGTTTCTGGGCCTGTAAATATTCCCCCACNGAAGCCCCATTTCATTTTT
CTGTTGTCTTATCATTGCCCTCTCCCCTTTTATCCNGACCTGGACAATACCTGTTNNNNNTCAATGAACTACTCACCCTT
CAAGGCCTAANTCACTTGTACNAGCTCTGCTACATAAAGCTGTCCAAGCAAGCTCTCTTCATTNNGTCNCCACTGTNNAN
ANCTTTAGGANANNCCTCANNTGTGGTNNNGTCNNCNTCTGGGCTGGGANNTACTTGANGGANANTACCTGNCTANTTCA
NCTCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15105C6HMR1
Sequence
NGTTGANCTGCAGCTGTGAGTGTGGTGGAGGCCACAGAGGCTGANAGCANACTGGTTCAGGTGACTGAAGGCCTGGACAA
GTGGAAAGCAGTTTGAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI13456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22097388..22097487 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]

 
Come back to gene ENSMUSG00000033581


For any suggestions or comments, please send an email to unitrap@crg.es