Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10074A2
Clone ID IST10074A2
Vector VICTR75
Project tigm

Sequence tag IST10074A2BBF1
Sequence
TTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAAAA
Sequence Type genomic DNA
Unitrap ID UNI30216 UNI36542 UNI36543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 18881690..18881733 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20069089..20069132 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5437551..5437594 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 57019156..57019199 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98144510..98144553 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 73044856..73044899 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022607 (Ptk2) NM_007982 PTK2 protein tyrosine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:95481]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18884558..18884601 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022702 (Hira) NM_010435 histone cell cycle regulation defective homolog A (S. cerevisiae) Gene [Source:MGI (curated);Acc:Hira-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 47740051..47740094 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 24260258..24260301 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 167780835..167780878 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 34605652..34605695 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34676620..34676663 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28537231..28537274 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037640 (Zfp60) NM_009560 zinc finger protein 60 Gene [Source:MGI (curated);Acc:Zfp60-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66791790..66791833 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 139061433..139061476 44
NO GENE  

 
Come back to gene ENSMUSG00000037640


For any suggestions or comments, please send an email to unitrap@crg.es