Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST434490
Clone ID OST434490
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST434490
Sequence
GCTGCAGCTGTTTGTGGACCACTGCGTGGCCACGCCTTCACCTTTGCCAGACCCGAACTCCTCCCCCTATCACTTCATCG
TGGACTTCCACGGTTGCCTTGTGGATGGTCTATCTGAGAGCTTTTCGGCATTTCAAGTCCCCAGACCCCGGCCAGAGACT
CTCCAGTTCACGGTGGATGTATTCCATTTTGCCAACAGCTCCAGAAATACGCTCTACATCACCTGC
Sequence Type mRNA
Unitrap ID UNI17875

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 136460309..136463139 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004948 (Zp3) NM_011776 zona pellucida glycoprotein 3 Gene [Source:MGI (curated);Acc:Zp3-001]

 
Come back to gene ENSMUSG00000004948


For any suggestions or comments, please send an email to unitrap@crg.es