Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14130G8
Clone ID IST14130G8
Vector VICTR74
Project tigm

Sequence tag IST14130G8HMR1
Sequence
CAGGGCTACACAGAGAAACCCTGTCTCCAAAAAACA
Sequence Type genomic DNA
Unitrap ID UNI1833 UNI13528 UNI36545 UNI36546 UNI36547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 88417555..88417590 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30358600..30358635 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69516818..69516853 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83600314..83600349 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 79774987..79775022 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 44431250..44431285 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31408741..31408776 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024033 (Rsph1) NM_025290 radial spoke head 1 homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:1194909]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88654221..88654256 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 47906179..47906214 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 48777110..48777145 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 119216906..119216941 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041460 (Cacna2d4) NP_001028554 calcium channel, voltage-dependent, alpha 2/delta subunit 4 Gene [Source:MGI Symbol;Acc:MGI:2442632]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 128088658..128088693 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030880 (Polr3e) NM_025298 polymerase (RNA) III (DNA directed) polypeptide E Gene [Source:MGI Symbol;Acc:MGI:1349452]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 90714880..90714915 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 56971984..56972019 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042557 (Sin3a) NM_011378 transcriptional regulator, SIN3A (yeast) Gene [Source:MGI Symbol;Acc:MGI:107157]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 49976730..49976765 36
NO GENE  

 
Come back to gene ENSMUSG00000042557


For any suggestions or comments, please send an email to unitrap@crg.es