Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14556H5
Clone ID IST14556H5
Vector VICTR74
Project tigm

Sequence tag IST14556H5BBF1
Sequence
GAGCTACAGAGGGCCTGGGACCTGCGGCCAAACTTACCTGNNNNNCTCCACCTCGGCGNCCCGCTCCAGCTCCAGCAGCT
GTAGCTGCTGGGCCACGAAACTCTCCACGGTGGACGAGGCCATCTGCTCCGCGATGCAGCCCCTGACTGATGCTTCCTGC
TCGGCCAGTTTAGTCCTGTGGGACCCGAGTTCCAGTCGGACCGTGTTCCCCACTGGACCAGAATCCGCAAAAGGCCCTGC
GCTCCCAGCCAGGGCGCGGATTCCCGGCCGGTCCGTTTCCTGCGTTCCCCGCCAAGCCAGTGATTGCAGTAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3282664..3282979 304
 
EST/CDNA Est Name
  NM_009212.1 - AK154805.1 - AK155899.1


Sequence tag IST14556H5HMR1
Sequence
GCTCTCCTTAGTTACCGCCTGGNAGCNNGTCTAGTGTTGGCTGGGTGAATGGCTAACACACANANACAGCCCTAGGAGAA
GACCGCACAGCAGCGTCACTTCGGGGCGTCGAGGCAAAAGGATCGGGAGTTCAAGATCACATTTTGGCTACGTAGCCAAT
TTGAAGTCC
Sequence Type genomic DNA
Unitrap ID UNI29595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3282501..3282667 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024831 (Ighmbp2) NM_009212 immunoglobulin mu binding protein 2 Gene [Source:MGI (curated);Acc:Ighmbp2-001]


Sequence tag IST14556H5HMF1
Sequence
AGCTACAGAGGGCCTGGGACCTGCGGCCAAACTTACCTGCGCTCCTCCACCTCGGCGTCCCGCTCCANCTCCAGCAGCTG
TAGCTGCTGGGCCACGAAACTCTCCACGGTGGACGAGGCCATCTGCTCCGCGATGCAGCCCCTGACTGATGCTTCCTGCT
CGGCCAGTTTAGTCCTGTGGGACCCNAGTTCCAGTCGGACCGTGTTCCCCACTGGACCAGAATCCGCAAAAGGCCCTNNN
NNNNNNNNNNNNNNNCGGATTCCCGGCCGGTCCGTTTCNNNCNNTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3282665..3282942 233
 
EST/CDNA Est Name
  NM_009212.1 - AK154805.1 - AK155899.1

 
Come back to gene NM_009212.1 - AK154805.1 - AK155899.1


For any suggestions or comments, please send an email to unitrap@crg.es