Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10571C6
Clone ID IST10571C6
Vector VICTR76
Project tigm

Sequence tag IST10571C6BBF1
Sequence
TAATATCTTATCCTTCTGCCTCCACCTCCACACTCCTGGCTGGCCTTGAACTCACGCCATTCCATCTCGGCCTTCTGAGT
GATGGGAATATAGACCCGTGCCGTGTGTGGCCTTCTGTTTGAGCCCAGGTCCAGCTTTCTCTTAGTGTCTAGCGTCATTG
ATGTTCCCCGGTAGCATCCTTGGTACACATTCTTTCTCCTAGTCTTATTCTATTGACTCTTTTGTTTGCTGCACTGCTTT
CATGTCTCTGTTTAGCCTCATCAACAGCTCTGGGTTTCCCTGCTGCGTACCTGCCCTTATGGTGAATTCTGGGAGAGACT
TGGAATGTACACCCTGGGGTGAGGGGTTGCTTGGCAAAGGGGAAGACTACCATTGAATAACNAATGANCACNNACNCNAA
CTCTGACTTAGTATTTCTTTGCCNGACACGANTCCNAGCCCTTTACAGTGNTTTCTGGCTTTACAAATGCTTN
Sequence Type genomic DNA
Unitrap ID UNI29712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40205438..40205909 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040111 (Gramd1b) NM_172768 GRAM domain containing 1B Gene [Source:MGI (curated);Acc:Gramd1b-002]


Sequence tag IST10571C6HMF1
Sequence
TAATATCTTATCCTTCTGCCTCCACCTCCACACTCCTGGCTGGCCTTGAACTCACGCCATTCCATCTCGGCCTTCTGAGT
GATGGGAATATAGACCCGTGCCGTGTGTGGCCTTCTGTTTGAGCCCAGGTCCAGCTTTCTCTTAGTGTCTAGCGTCATTG
ATGTTCCCCGGTAGCATCCTTGGTACACATTCTTTCTCCTAGTCTTATTCTATTGACTCTTTTGTTTGCTGCACTGCTTT
CNTGTCTCTGTTTAGCCTCATCAACAGCTCTGGGTTTCCCTGCTGCGTACCTGCCCTTATGGTGAATTCTGGGAGAGACT
TGGAATGTACACCCNGGGGTGANGGGNNNNTNGNNNNANGGGAANACTACNNNNNANTAACAAATGANCNCTNACNCAAA
CTCTGACTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040111


For any suggestions or comments, please send an email to unitrap@crg.es