Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15016H6
Clone ID IST15016H6
Vector VICTR78
Project tigm

Sequence tag IST15016H6HMR1
Sequence
NTGGAATTTGANGTGTAAATTTTTATAAAATCCGCATTCTTTGTTGTGTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100637597..100637646 48
NO GENE  


Sequence tag IST15016H6BBF1
Sequence
CTCAGCATATAGTGAGGGGCTTCCTGTGGTATAACAGGGTTGAGGACAGCAGGATGGTGACATTAATCCATTCCTGTGGT
CAGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI14116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8886266..8886354 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025277 (Abhd6) NM_025341 abhydrolase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913332]

 
Come back to gene ENSMUSG00000025277


For any suggestions or comments, please send an email to unitrap@crg.es