Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13870D8
Clone ID IST13870D8
Vector VICTR74
Project tigm

Sequence tag IST13870D8HMF1
Sequence
ATGACGAATCCCCAAGAGAGCAAGACGATTGCAAGGAGCAACTAAAAGGAGGGGAGGAAAAGCAAAAAGAAGAAATCAAT
GTGCCGGGTCCTTTCCCTGTGTAGCCCGAGCAAGCAGCTACAGGTGGAAAGGCATCACATGCCTCTAACACAGTGCAGCC
CANAGGCAAGCAGGCCTGCAACCCCTGACGTCANAGGCGGAAAAGCGTGTCCTCCAGGAANAGGCGGAGCCGAGGGCAGG
GCGTGAACGCTCAATTTANGAATGGGTTCTGGANTTCCAAGCTGCNANCCNACNGTCTACCTTCGGCTCGCGGGCNNTGC
CATGGTGCGCTCNGGANCTCCGCTNNGCTCNGTACNNACCANGGNNNAAGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13870D8BBF1
Sequence
ATGACGAATCCCCAAGAGAGCAAGACGATTGCAAGGAGCAACTAAAAGGAGGGGAGGAAAAGCAAAAAGAAGAAATCAAT
GTGCCGGGTCCTTTCCCTGTGTAGCCCGAGCAAGCAGCTACAGGTGGAAAGGCATCACATGCCTCTAACACAGTGCAGCC
CAGAGGCAAGCAGGCCTGCAACCCCTGACGTCANAGGCGGAAAAGCGTGTCCTCCAGGAAGAGGCGGAGCCGAGGGCAGG
GCGTGAACGCTCAATTTANGAATGGGTTCTGGAGTTCCAAGCTGCGAGCCNACAGTCTACCTTCGGCTCGCGGGCCCTGC
CATGGTGCGCTCTGGANCTCCGCTCTGCTCGGTACCTACCAGGGAGTAAGTCCNGTCCNGGCTTCGGCGACTCATCNGCC
TNNNGGTANGGGANCANCGGGN
Sequence Type genomic DNA
Unitrap ID UNI22386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40216691..40217111 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036822 (Topors) NM_134097 topoisomerase I binding, arginine/serine-rich Gene [Source:MGI (curated);Acc:Topors-001]

 
Come back to gene ENSMUSG00000036822


For any suggestions or comments, please send an email to unitrap@crg.es