Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12859H5
Clone ID IST12859H5
Vector VICTR76
Project tigm

Sequence tag IST12859H5HMR1
Sequence
ACACAATCTAGGGTAATGTGGGAAGAGGGAACTTCAAATGAGAAAATGTCCCCATCAGATTGGCTTGGGAGGTATTTCCT
GTTGTGAGAGGGTCCAGCCCGTTGTGGGTGGAGTCATCCTGGGCAGATGGTGCTGGGTTGTTTAAGAAGCAATCTGAGCA
GGCCAGTGAGCAGTGTTTCTCCATGGCTTCGCTTTCAGTTCCTGCCTTAACTTCTCTGGGTGATGGATTATAAGCTGTAA
TGTGAAATAAACTCTCATTTTACCAAGCTGCCTTTGGTTATAGTGTAGAACTAAATCAATATACGATAGCCCCATTGGTT
TAGCTGCTGCTGAGAGCTGTGACTGAN
Sequence Type genomic DNA
Unitrap ID UNI34181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34620657..34621002 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037224 (Zfyve28) NM_001015039 zinc finger, FYVE domain containing 28 Gene [Source:MGI (curated);Acc:Zfyve28-001]

 
Come back to gene ENSMUSG00000037224


For any suggestions or comments, please send an email to unitrap@crg.es