Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10857C1
Clone ID IST10857C1
Vector VICTR76
Project tigm

Sequence tag IST10857C1HMR1
Sequence
NGGCACAAAGAGAAGGGGTTCAGGAAGAGCAGTCAGGACCAGGAAGTTTGAAAAGAAAGGAAGCATGTGGTAGGGTAGAG
ATGGAAGGGANCTTTGTGAAATATGGTCAGTGGTTGAGGAAACNNGGAAACATTAAATGTGACGGTCTTAANTTCNNGAC
Sequence Type genomic DNA
Unitrap ID UNI36552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 112528938..112529091 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044465 (4632419K20Rik) NP_950174 family with sequence similarity 160, member A2 Gene [Source:MGI Symbol;Acc:MGI:1921599]


Sequence tag IST10857C1HMF1
Sequence
NATTACCTGCAATTACTCATCACATGCANATTTTGAAATCTCTCCTGATTTCTTANTGTCTGAAAGATCCAACTTCTGCT
CANCCTAACTGCCACTCTAAAAACCACTCTTACTCCGGCTAAAGTTTTCCTGTCTTACCATCAAATGTTCCACAACCTTG
TAAAACTCCCTATTCCAACTAAAATCTAANATGTCTCCTGAATACNANCANAATACATCTATACCTACCTAATCCCTACT
TATTACTTAAGGCCACATATNNCATNNNGCTCTCACAATACCTCAACCCANTAACTTCCTTCTCCTTCCCTGTCCCTANA
CCCTTATACAGTTTGTGTTGATACTGNNNATTANNCTCTTTTAATAAAACAACTGGATTCTCTGACCCANAGCCTGACAC
AAAAACTTGCTTTTCAACAACTCTTCAGTTTATGCTTCTTAACNAATGCTNNACAATGAAATATN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000044465


For any suggestions or comments, please send an email to unitrap@crg.es