Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14518F12
Clone ID IST14518F12
Vector VICTR74
Project tigm

Sequence tag IST14518F12HMF1
Sequence
CAGTGACTTACAGCCATTTCCAGTTCCAGGCAATCTAATGCTTTCTTTCTGACCTATGTAGGCACCAAGTAAAACATGGT
GCATACACATACTTGAAAGCAAAACACCCATTATAAATAAATCTTAAAAAAACAAAAACAACTGGGCAGTGGTGGCGCAC
GCCTTTAATCCCAGCACTTGGGAGGTAGAGTCAGGTGAATTTCTGATTTTGAGACTAGCCTGGTCTAAAGCGTGAGTTCC
AGGACAGCCAGGGCTATACAGAGAAACCCTGCCTGGAAAAACCAAAAACCAGGAAAAAAACAAAACAAAACAAAACAAAA
CAGGAAAAGAAAGAAAAGCTGTAGAGATGGCTCAGTGGTCAAGCGCACTGACTGTTCTTCGAAAGGTCCTGAGTTCAAAT
CCCAGCAACCACATAGCGGCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17247052..17247472 421
 
EST/CDNA Est Name
  BY127907.1


Sequence tag IST14518F12HMR1
Sequence
ACTGGGTCCTTTAAAAGAACAAGTCCTCTTAACCCCTCTGAGTCATCTCTCCAGCCCCTANATTTGTCTTGCTTTTTATT
ATATGTTTGTGTGTGGGTGTACCCACACGAGCACAGGTACCTTCAGANAACAGAGGTGCTGGATTACCCTGGAGTTGGAG
TTGGANCTGTCNGAANTGGGGGCTGNNAN
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17247469..17247653 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es