Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14213F1
Clone ID IST14213F1
Vector VICTR74
Project tigm

Sequence tag IST14213F1HMF1
Sequence
GACCNGGACTCGTGTGTCGATTTGAAGGAAGCGAACTAACCTGTAAAGTGGGCTTACAGGGGAAAGGAGTGTGGCTAGAT
GTTTGGGAGGGGCCAGAAGAGGCGGAGGTTTTTTTTGGATGGGCTTTCTTGCATTGTACCGTAGCCAGAAAAAGAGAAGG
CACGGTCAAGCAAAACTGAGCANAACTCTAGTTCTGCTTTGATAAACGGGTTGTAGGGAAAGGGGAAATGCTAGAAAGAG
GTAGGAGGTTACTGCCTAGTCTAGAACCGGGGTGGGGTGGGGGTGGGGGTNNTCN
Sequence Type genomic DNA
Unitrap ID UNI24143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87437467..87437756 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]

 
Come back to gene ENSMUSG00000053693


For any suggestions or comments, please send an email to unitrap@crg.es