Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST434194
Clone ID OST434194
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST434194
Sequence
TAGGAGCCATGTCCACCTTGTTCCCGTCACTCTTCCCTCGTGTGACTGAGACACTGTGGTTTAATCTGGACCGACCCTGT
GTGGAGGAGACAGAGCCTGCAGNACCATGAGCAGNAGCATCAGGCCTGGCTCCAAAGCATCGCAAAGAAAGACAACAACC
TGGTACCAATTGGCAAGCCGGCCTCAGAGCACTACGATGATGAGGAAGAAGAGGATGATGAAGATGATGAGGACAGTGAA
GAGGATTCCGAAGATGATGAGGACATGCAAGACATGGATGAGATGAATGACTATAATGAGTCACCTGATGATGGAGAGGT
CAATGAGGTGGACATGGAAGGCAACGAACAGGATCAGGACCAGTGGATGATCTAGGTAGACNAGCCNGGGTGGCCTNAGT
GATTCCAGACCACCC
Sequence Type mRNA
Unitrap ID UNI16253

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109046458..109047795 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030649 (3200002M19Rik) NM_027532 RIKEN cDNA 3200002M19 gene Gene [Source:MGI Symbol;Acc:MGI:1922680]

 
Come back to gene ENSMUSG00000030649


For any suggestions or comments, please send an email to unitrap@crg.es