Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10917C12
Clone ID IST10917C12
Vector VICTR76
Project tigm

Sequence tag IST10917C12HMF2
Sequence
TTGGGAGGCANAGGCAGGCGGATTTCTGAGTTCGAGGCCANCCTGGTCTACAGAGTGAGTTCCANGACN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10917C12HMR1
Sequence
NNAGTGCTGGGATTAAAGGANTGCGCCACCACACCCAGCTCTGCCTTGCCTTCTTGAATGCGGGGAGTACAGACAGCAAT
CTACTACACTCTCCTTGTTTCCACAGTGACAGCTCTCGGGGCAGCTGAGGGCTGGCACACGTGGCAGTGTGATAGTCCAC
GAGGTGGCTGAGTGGGAGGAGGCTTTANAATTCCTCTCTCCCTGCGCCTGCCGACTCCGGCTACGCCTGCNNGCNNNATC
CNANANNTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 106531080..106531318 225
NO GENE  


Sequence tag IST10917C12BBF1
Sequence
TTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCNGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTAT
ACAGAGAAACCCTGTCTNAAAAAAC

Sequence Type genomic DNA
Unitrap ID UNI17559 UNI32255 UNI36557 UNI36558 UNI36559 UNI36560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 181609184..181609288 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038936 (Sccpdh) NM_178653 saccharopine dehydrogenase (putative) Gene [Source:MGI (curated);Acc:Sccpdh-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 111245130..111245234 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23140480..23140584 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 61113971..61114075 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 31780148..31780252 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021918 (Nek4) NM_011849 NIMA (never in mitosis gene a)-related expressed kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1344404]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 31416525..31416629 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039100 (March6) NM_172606 membrane-associated ring finger (C3HC4) 6 Gene [Source:MGI Symbol;Acc:MGI:2442773]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3955761..3955865 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049871 (AC129021.4-201) NP_001074749 NLRC3_MOUSE Isoform 2 of Q5DU56 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q5DU56-2]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74699835..74699939 101
 
EST/CDNA Est Name
  AA718719.1 - AI120455.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 106531318..106531422 101
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110631302..110631406 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029502 (Golga3) NM_008146 golgi autoantigen, golgin subfamily a, 3 Gene [Source:MGI (curated);Acc:Golga3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22107039..22107143 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066829 (Zfp810) NM_145612 zinc finger protein 810 Gene [Source:MGI Symbol;Acc:MGI:2384563]

 
Come back to gene ENSMUSG00000066829


For any suggestions or comments, please send an email to unitrap@crg.es