Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14582C4
Clone ID IST14582C4
Vector VICTR74
Project tigm

Sequence tag IST14582C4HMF3
Sequence
AAACTATTTATTTATTTATTTAAAGACAGAATCTCATCNTGTACCCCTGGCTGGCCTGGAACTTGCNATGTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI5440

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 123303147..123303222 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028649 (Macf1) NP_033730 microtubule-actin crosslinking factor 1 Gene [Source:MGI (curated);Acc:Macf1-001]


Sequence tag IST14582C4HMR1
Sequence
GGGCTAGCACCTAGGTATGGTAGCTCCTAGGTAAGTGCTCGCCCACTGAAGCATATCAGGTGGTGGTTTGCTTCTGTTAA
GACAAAACTCANGCCTCATACATGCTAAGCTAATGCTCTCCCATTGTGCTACAACCCCAGCCTCAGTATGTTTTCTTTAC
ATCAGCCACATGCAGGATGTATGGAAGTTGTTTTGCATGGTTGAGTGAAAATTGGGATATTTTANAAGTGAGTTTCATTT
TAATAAATATACNGATTANATCTANATTCTGTATTGGTTGTGGTTGATGTTTTCAGAAGTTTTNCCCTGCTTANTTTGTA
NAGATTGGTGCCNNTCTNTCTTGGGTGANCACCTGCNCTGN
Sequence Type genomic DNA
Unitrap ID UNI14434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92042182..92042541 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]


Sequence tag IST14582C4BBF2
Sequence
AAACTATTTATTTATTTATTTAAAGACAGAATCTCATCGTGTACCCCTGGCTGGCCTGGAACTTGCTATGTGGCCAAGGC
AGGCCTTGACTTTGTAATCTTCCTGTGCCAGCCTCCTAAGTAGTGGTTGATTACAGTCCAGGCCACTAGGCAGCTGATGA
TAGTGTTGCTTTTAGTTTCCATTTTTAGCTCCATTTCATACTTGATGAAATAGAAGATCAGAAAGACATAGTGACATGCC
CAAAGATACACAGCTGACTGGCAGCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI5440

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 123302952..123303222 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028649 (Macf1) NP_033730 microtubule-actin crosslinking factor 1 Gene [Source:MGI (curated);Acc:Macf1-001]

 
Come back to gene ENSMUSG00000028649


For any suggestions or comments, please send an email to unitrap@crg.es