Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14547C11
Clone ID IST14547C11
Vector VICTR74
Project tigm

Sequence tag IST14547C11BBF1
Sequence
ACAATAGAGACTGAAATCTCCCCAGGGCGCCCCTAAAAAAGCCACAGACAAGAAACTNNGNGNNCNCATTATGGGGAAGG
AAAACAAAGTCCCAGAGGATAAGGCTCCTCCCCAAAGCAGGCCGTGGGGCTCCAGCAGTTTTCCAAAGCTACCCCTCCTT
GGGGATGGGACCGAAGCTCGTACACCTGTCTCAGGAGGGGCCTCCGTTGTTCCCCTTACTCCGTAATGCCGCACTCGGAN
GAACACTGAGGGGAAAAGGCAGGCAGCACCGCTGGGGCTAGAGCGCTGTGACTTTNAGANCCNANGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54788265..54788573 287
 
EST/CDNA Est Name
  CA481210.1 - CA493552.1 - BY253115.1 - BF321966.1 - BB864100.1 - BB848104.1 - BY193071.1 - BY189351.1 - BY775876.1 - BB841172.1 - BY178832.1 - BY074150.1 - BB873129.1 - BY192205.1 - CJ180893.1 - BY008426.1 - BY181468.1 - BY142712.1 - BY134666.1 - BB868625


Sequence tag IST14547C11HMR1
Sequence
TTGTTAATAAGGCTTAGCCGAAACTAAAGGGGTTCTTTAACCAAGGTCACCCAGGGAGTCT
Sequence Type genomic DNA
Unitrap ID UNI22489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54788208..54788268 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034928 (Rnf44) NP_598825 ring finger protein 44 Gene [Source:MGI Symbol;Acc:MGI:2145310]

 
Come back to gene ENSMUSG00000034928


For any suggestions or comments, please send an email to unitrap@crg.es