Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST434120
Clone ID OST434120
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST434120
Sequence
GCGGTCCACCAAGCTTNGATGAANGTNCNGNTGTNGGACCACCATCACCCNGGNCNCCCTTTGATCTTANNAGTNATGAG
ANCCCATNTTCNCAGACTGGGGCTGNAGNGGCNCGAGCTTNTGGTACGAAAGCTCTNTNCGTATGCNCTGNNTGAGNACG
AGNAACTTCCTACCGAAATTGAACATAGNGACNGCNTATATTGCCCGCCTGATANAGGAGANTANNTACTTGGCAGAAGN
AGNTACAGCGCGTGCTNTACNTGGCTNAGACTATCTGCCANGCGTGCCTGACNTACCTCTGGATAACTTTGTTTCTCCGG
ATAGTCAGGAATTTGATTCTGAAGAAGAAGCTGTTGAGTATTCAGAACTGGAAGACTCAGGAGCTGGGACGTGTGCTGAA
GAGACTGTG
Sequence Type mRNA
Unitrap ID UNI17896

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 24843971..24845327 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006715 (Gmnn) NM_020567 geminin Gene [Source:MGI (curated);Acc:Gmnn-001]

 
Come back to gene ENSMUSG00000006715


For any suggestions or comments, please send an email to unitrap@crg.es