Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14114F4
Clone ID IST14114F4
Vector VICTR74
Project tigm

Sequence tag IST14114F4BBF1
Sequence
TTANNNCCCTGACNTGTTACTATGTATACNTNNTTACTGTACANCCTCTCAATTTAAATTTAATGGCCNGGGAANANGGA
CTTAAATTTGCTCANNNNGNATCCTANACACTAAAATAATACCTGGCNTANAGTAATAAAAAATANCTGATAANCTGACT
TGTCTGTTACTGAANAATGGGTCCNAGGACGCATAGCTGTTCTGCATCTGTGACCCACAAANATTCTGGCCNGCTGCCNN
CTNNNTCTCCTTTCTGTATTACNATGTTTGGTTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14114F4HMF1
Sequence
TTATAACCCTGACATGTTACTATGTATACATCATTACTGTACAGCCTCTCAATTTAAATTTAATGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107719251..107719317 67
NO GENE  


Sequence tag IST14114F4HMR1
Sequence
TAACAGTGTTCCCAGAAAGATTACGGCTGTCAGACGTTAGAACGTCTGGTGGAGGGATTGTTATGCTTCGCTTTCGTTGT
CC
Sequence Type genomic DNA
Unitrap ID UNI8225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107719173..107719253 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042590 (AC165281.2) NM_029665 Importin-11 (Imp11)(Ran-binding protein 11)(RanBP11) [Source:UniProtKB/Swiss-Prot;Acc:Q8K2V6]

 
Come back to gene ENSMUSG00000042590


For any suggestions or comments, please send an email to unitrap@crg.es