Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14638A7
Clone ID IST14638A7
Vector VICTR74
Project tigm

Sequence tag IST14638A7BBF1
Sequence
ACTGGGGCTCTTACTCTGGCAAACATAGATGGCTGGAACAGTGCTGAACAGAAACCACAAGGGAAGAATTCATGACCTTA
CATTTTACATCTTTCTTATTTACAGAATTGGGTGCTCCTTTTAAGTTTGATTTCTACGTCTGGATGGACTCTGCCATGCT
TGGACCACAGCTGTAGCAGGTTTTCTATGAAGCTCCTCCAGGAATTCCGGACTAGAAATCACTTANCCTACCTACCCACC
CCCCACCTCACCCNCNTTTCCATTCATTGAAGGCTTAGCANGAGGGTGTGTTTTCCTTAGGCGTGTCTCNNCATTTGGCT
GCTATTTGANACTATCCAATGTTGCTTTNCTCTACAANCCACAGACTGCATTTATTTCTGCNNNNCTTCNNGTTGTTGTN
GTNGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121809725..121810126 370
NO GENE  


Sequence tag IST14638A7HMR1
Sequence
CAGTGAGGGAGGAAACTGTGAGAGTACTTTGAATGAN
Sequence Type genomic DNA
Unitrap ID UNI1559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121809693..121809728 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078564 (BX000432.7) Novel zinc finger protein Fragment [Source:UniProtKB/TrEMBL;Acc:B1AZK8]

 
Come back to gene ENSMUSG00000078564


For any suggestions or comments, please send an email to unitrap@crg.es