Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14941G6
Clone ID IST14941G6
Vector VICTR76
Project tigm

Sequence tag IST14941G6HMR1
Sequence
GAGGCAGGCGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACA
Sequence Type genomic DNA
Unitrap ID UNI2336 UNI15268 UNI29550 UNI30899 UNI31302 UNI31999 UNI32134 UNI35417 UNI36564 UNI36565 UNI36566

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4887729..4887770 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033813 (Tcea1) NM_011541 transcription elongation factor A (SII) 1 Gene [Source:MGI Symbol;Acc:MGI:1196624]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4820223..4820264 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3112069..3112110 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020454 (Eif4enif1) NM_023743 eukaryotic translation initiation factor 4E nuclear import factor 1 Gene [Source:MGI (curated);Acc:Eif4enif1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3640431..3640472 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071454 (Dtnb) NM_007886 dystrobrevin, beta Gene [Source:MGI Symbol;Acc:MGI:1203728]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3631541..3631582 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8600517..8600558 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058570 (AC129222.4-202) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3TZ95]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 6639635..6639676 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3150885..3150926 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4678174..4678215 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3392088..3392129 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3937537..3937578 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036908 (Unc93b1) NM_019449 unc-93 homolog B1 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1859307]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3443053..3443094 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5276000..5276041 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3794927..3794968 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 4314076..4314117 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3587233..3587274 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3211515..3211556 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3518563..3518604 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3614673..3614714 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041624 (Gucy1a2) NM_001033322 guanylate cyclase 1, soluble, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:2660877]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 134874..134915 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_112000: 65035..65076 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_162750: 57904..57945 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079219 (AC132444.3-204)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 139029..139070 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030768 (Disp1) NP_081142 dispatched homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1916147]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166280: 137307..137348 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 53530..53571 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079194 (AC133103.5-209) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3UT50]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166291: 42819..42860 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166310: 137028..137069 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047323 (Tsnax) NP_058605 translin-associated factor X Gene [Source:MGI Symbol;Acc:MGI:1855672]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 115342..115383 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3190239..3190280 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 432795..432836 42
NO GENE  

 
Come back to gene ENSMUSG00000047323


For any suggestions or comments, please send an email to unitrap@crg.es