Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AS0135
Clone ID AS0135
Vector pGT0lxr
Project sanger

Sequence tag AS0135
Sequence
AGTCTGCTCCAACAGTTGTGGGTGGCGGCGTTGAGGTTCGGCACTCTGGCTCCTTTGCGGCCCCGGGGTCAGGATGGACT
TCCCTGGCACCCTGCGCCCTTCATTGTTTAAGGCCGGTCCACTTGGCATGACTGATGGCCCTGACCTGTCCTTCATGTGC
AGCTGGAGAGATGCACTGACCCTGCCAGGGTCCCAGCCACAAAACTGCAAG
Sequence Type mRNA
Unitrap ID UNI3441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122128140..122129106 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031832 (Taf1c) NM_021441 TATA box binding protein (Tbp)-associated factor, RNA polymerase I, C Gene [Source:MGI (curated);Acc:Taf1c-001]

 
Come back to gene ENSMUSG00000031832


For any suggestions or comments, please send an email to unitrap@crg.es